Extraction of Genomic DNA, Determining its quantity and quality, Polymerase Chain Reaction and Molecular tools

Table of Contents

1. Abstract………………………………………………………………………………………..3

2. Introduction…………………………………………………………………………………….4

3. Materials and Methods…………………………………………………………………………8

4. Results………………………………………………………………………………………..18

5.0.Discussion……………………………………………………………………………………21

6.0.Conclusion……………………………………….…………………………………………..25

7.0.References……………………………………………………………………………………26

1.  Abstract

The gyrA gene found in Escherichia coli has been found to convey resistance of the bacteria to the broad spectrum antibiotics quinolones. The aim of this three day workshop was to isolate this gene of interest from a culture of E. coli using a kit based method. The quality and quantity of DNA extracted was to be determined using spectrophotometry. In order to clarify that DNA was actually extracted, agarose gel electrophoresis was utilized. Once DNA was extracted, the DNA was then to be amplified using Polymerase Chain Reaction (PCR). Two different PCR master mixes were to be used and compared, one a commercial master mix and the other a traditional master mix. The products then of PCR using the two different master mixes were to be compared using gel electrophoresis. Basic Local Alignment Search Tool (BLAST) was to be used to analyse the extracted DNA nucleotide sequence with their database and PubMed to compare this study with other previous studies. The results of this workshop was that the DNA gyrA gene was extracted successfully from the E. coli culture due to a band present in the well of the gel. Although the DNA isolated was not pure DNA. This was evident due to spectrophotometry results suggesting that the DNA was not pure. Also there was more than one band present in the gel electrophoresis. In a clinical situation, this study would have been repeated due to the controls giving unexpected incorrect results. The BLAST results showed 100 percent alignment with the gyrA sequence found in its database. PubMed provided valuable information regarding other similar studies carried like this workshop. What can be concluded from this study is that DNA can be successfully isolated using the kit method, the quality and quantity determined using spectrophotometry and that there are no advantages using commercial master mix over traditional master mix, only that the commercial master mix does not need to be made up, therefore less time used.

2.  Introduction

The gyrA gene present in Escherichia coli isaccountable for E. coli’s resistance to quinolones. Its resistance is because of mutations in the gyrA gene leading to different amino acid at positions 83 and 87. These amino acids are located close to the DNA gyrase active sites and the tyrosine residue that bonds with the single strand in the topoisomerase reaction. The mutations in the active site changes the binding of quinolone, resulting in E. coli’s resistance to quinolones.

Quinolones belong to the family of broad spectrum antibiotics which are prescribed to fight human and animal infections. They are specifically used to target E. coli and Gram negative bacteria by targeting their DNA gyrases and topoisomerases IV. As a result of the increased use of quinolones, bacterial resistance has occurred (Qiu et al., 2018).

Genomic DNA extraction is the removal of DNA from an organism using a mixture of chemical and physical procedures. There are numerous different kits available to carry out this extraction for the chemical procedure, accompanied by physical procedures involving centrifugations.

There are four stages of extraction: disruption, lysis, elimination of contaminants and DNA recovery. In disruption and lysis stage, which are frequently combined, the cell membranes are broken to release the DNA as well as the cytoplasmic contents. A lysis solution which contains the necessary salts to affect the acidity and osmolarity of the cells carries out this step. The lipids and nucleus released are degraded with detergents and surfactants. Proteinase K is added to digest the contaminants. The solution is then mixed with concentrated salt solution in order for clumping together of broken proteins, lipids and RNA. The solution is then centrifuged, causing separation of the DNA from the clumped cellular debris. The DNA is then purified to remove remaining contaminants. This can be carried out using a method such as ethanol precipitation by ice cold ethanol. As DNA is not soluble in alcohol, it will therefore clump together, resulting in a pellet when centrifuged. After DNA is isolated, the DNA is then dissolved slightly in an alkaline buffer such as TE buffer (Yoshikawa et al., 2011).

Sigma’s GenElute Bacterial Genomic DNA Kit is an example of a commercially available extraction kit used for genomic DNA extraction. This kit allows a convenient and efficient way to extract DNA from a variety of bacterial cultures. This kit combines the benefits of both a silica-based system and a microspin format leaving out the need for the expense of resins, precipitation using alcohol and dangerous organic compounds. Lysis of the bacteria occurs in a chaotropic salt containing solution to make sure that the macromolecules are denatured. Ethanol is added so that the DNA will bond with the column when the lysate is spun through the silica membrane entering the microcentrifuge tube. Following the washing step to remove contaminants, the DNA is eluted in Tris-EDTA solution (Sigma-Aldrich, 2018).

The yield of DNA will depend on the bacterial culture cell density, the species and strain. The DNA that is purified, can have its quality and quantity determined using the A260/A280 ratio, where a pure sample of DNA has a ratio between 1.6 and 1.9 and may be up to 50kb in length. The DNA is measured spectrophotometrically at two different Ultra Violet (UV) ranges, as nucleic acids, RNA and DNA absorb light at 260nm, while proteins absorb at 280nm. A ratio of 1.9 – 2.0 is an indication of high amounts of RNA present, not pure DNA. A low ratio will indicate high amounts of protein as protein absorbs at 280nm (Lucena-Aguilar et al., 2016).

Once isolated, DNA is then ready for applications such as gel electrophoresis and PCR. Agarose gel electrophoresis is a technique used to separate a mixture of macromolecules, for example, DNA and proteins, in an agarose matrix. Agarose gel electrophoresis is an commonly used  technique for separating DNA of various sizes, starting from 100bp to 25kbp. To separate DNA using agarose gel electrophoresis, the DNA is placed in pre-cast wells in the gel and a current is then applied. The DNA phosphate backbone has negative charge and when loaded in an electric field, the DNA will travel to the positive anode. As DNA has a mass/charge ratio that is uniform, DNA will separate according to size in the agarose gel in a pattern where the distance migrated is inversely proportional to the log of its molecular weight. Following separation, the gel is visualised under ultra violet light after staining with an appropriate dye. A loading dye is used along with the loading of the DNA samples. The loading dye allows tracking how far the DNA has travelled through the gel as well as helping the DNA sample sink into the gel. The coloured dye also acts as a front wave, where it travels faster than the DNA molecules and when it reaches the end of the gel, the current is stopped. A molecular weight marker is employed, where it contains DNA fragments of known size, which act as standards and allows estimation of the size of the DNA in the sample (Lee et al., 2012).

Polymerase Chain Reaction (PCR) efficient way of amplifying a single or a few copies of a specific DNA sequence to produce multiple copies of the DNA in the thousands to millions in a short span of time. PCR is able to overcome the limitations of some other molecular techniques such as their labour intensiveness, time consuming, expense and large sample volume required. PCR allows amplification and the study of genes and their RNA transcripts from various samples. Each PCR assay needs a template DNA, primers, DNA polymerase and nucleotides.

The DNA region of interest known as template DNA that is amplified, ranges from 100 to 1000 base pairs in length. The primers used are short, single stranded sequences of nucleic acids, approximately 16 to 20 base pairs in length selected to anneal specifically a particular nucleic acid sequence. Forward and reverse primers are the pair of primers used. The DNA replicating key enzyme is the DNA polymerase that links individual nucleotides together to form the PCR product.

Once DNA is extracted, it is added to the PCR reaction mixture which contains primers, enzymes and components that are essential for the polymerase activity, a tube and is placed then in a thermal cycle which enables repeated cycles of DNA amplification to happen in the following steps:

1. Denaturation: the double strands of DNA are separated into two single strands is carried out by heating the mixture to 94°C.
2. Annealing: this step occurs at 50-58°C, where the primers are combined with the denatured DNA. The forward primer anneals at one end of the target sequence strand to a specific site and the reverse primer anneals to the opposite end of the complementary target strand.
3. Extension: DNA polymerase synthesises new complementary strands by the extension of the primers at 72°C. Commonly used is taq polymerase as it has the ability to function efficiently at the higher temperatures.

Automated thermal cycles are available that perform the PCR reaction, with each step performed at the correct temperature and duration. Generally, the PCR steps are repeated approximately 30 times. When the 30 cycles are completed, the mixture contains about 2³⁰ molecules of the target product. Following amplification, various techniques are available to detect the amplified product, where the simplest method is to identify the product by size following migration via electrophoresis in agarose gel. The products are visible as a single band corresponding to the size of the amplified DNA sequence through the molecular weight ladder and it fluoresces when it illuminates in Ultraviolet light (U.V) (Maheaswari, Kshirsagar and Lavanya, 2016).

Basic Local Alignment Search Tool (BLAST) is an algorithm of sequence alignments which quantifies the homozygousity between a pair of nucleotides or amino acid sequences. BLAST is widely used in research. BLAST is computationally efficient and is frequently used world wide, although BLAST is less sensitive than other methods available. BLAST is generally accessed through web applications. BLAST is effective in producing rapid sequence homology scores against other databases. It can be utilized for numerous purposes which are, identifying unknown species, locating domains, establishing phylogeny by creating a phylogenetic tree, DNA mapping where BLAST can compare the chromosomal position of the sequence of interest to relevant sequences and comparison where BLAST can locate common genes in related species (Oehmen and Nieplocha, 2006).

PubMed is a web based search engine provided by the United States National Library of Medicine which allows access to the MEDLINE database of over 28 million citations for biomedical literature. PubMed provides links to journals, articles, books and other related resources (Roberts, 2001).

The aims and objectives of this workshop are:

Extraction of bacterial genomic DNA from E. coli isolates using the kit method, determining the quantity and quality of extracted  DNA using U.V spectrophotometer, using gel electrophoresis to clarify that DNA has been isolated, amplification of a fragment of the gyrA gene from E. coli using Polymerase Chain Reaction and utilization of BLAST and PubMed.

 

 

 

 

 

 

 

 

 

 

 

0.  Materials and Methods:

The materials used were:

For Genomic DNA extraction:

An overnight bacterial broth culture which was E. coli (ATCC 25922),                        micropipette (Labnet Serial Number: 944081187),                                                          micropipette (Labnet Serial Number: 044040078),                                                         micropipette (Labnet, Serial Number: 944040550),                                                               Sarstedt micropipette tips,                                                                                                         micro-centrifuge tubes 1.5ml.

For spectrophotometry:

UV cuvettes (Sarstedt Lot number 5082611),                                                                        Scientific Calculator.

For agarose gel electrophoresis:

Wooden spatula,                                                                                                                         weigh boat,                                                                                                                                conical flask (100ml),                                                                                                              magnetic stirrer and retriever,                                                                                           micropipette (Labnet, Serial Number: 944081187),                                                           micropipette tips,                                                                                                                         tissue paper,                                                                                                                      thermometer.

For PCR:

PCR reaction tubes,                                                                                                           micropipette (Labnet, Serial Number 044040078),                                                                     micropipette tips.

 

 

 

 

 

 

 

 

The reagents used were:

For Genomic DNA extraction:

Lysis solution T (Sigma Lot number: SLBM7907V),                                                              RNase A solution (Sigma Lot Number: SLBM4913V),                                                      Proteinase K from Tritirachium (Sigma Lot Number: SLBK3315V),                                       Lysis solution C (Sigma Lot Number: SLBL6512V),                                                            Column Preparation Solution (Lot number SLBN3073V),                                                           95% Ethanol (Retrace code 00612194),                                                                                     Wash Solution 1 (Sigma Lot number SLBN8365V),                                                                 Wash Solution Concentrate with EtOH added (Sigma Lot number SLBN7639V),                                                                                                                          Elution Solution (Sigma Lot number SLBM3559V).

For spectrophotometry:

Sterile distilled water.

For agarose gel electrophoresis:

Agarose powder (Molecular Biology Grade requirements),                                                          1X TAE (40mM Tris-HCL, 40mM Acetic acid, 2 mM EDTA, pH 7.8),                                     Gel Red Nucleic Acid Stain 10,000X in water (Biotium Lot number: 16G1010),            Hyperladder I 100 lanes (Bioline Lot number: H1-111A),                                                                                                                  Loading dye (Blue/Orange 6X loading dye Promega lot number: 0000137015 expires 14-10-2020).

For PCR:

5X Green GoTaq Flexi Buffer (Promega Lot Number: 0000246589),                                     DNTP mix (1.2mM opened 05/09/2018),                                                                                   PCR grade water,                                                                                                                        MgCl2 (25mM Promega Lot number; 0000152734),                                                              Forward Primer (gyrAF1 5’-GAGGAAGAGCTGAAGAGCT-CCT Sigma Lot number: 8624649027-000020),                                                                                                              Reverse Primer (gyrAR1 5’- CCGGTACGGTAAGCTTCTT-CAA Sigma Lot number: 11-00001),                                                                                                                                       GoTaq G2 Flexi DNA Polymerase Lot number: 00020272),                                                                                         Gotaq G2 Green Master mix (lot number: 0000248738).

The equipment used were:

For Genomic DNA extraction:

Centrifuge (Micro Centaur Serial Number: 83939/23),                                                          incubator (Julabo Model: TW8, Serial Number: 10291832),                                                       vortex (Model: Lab dancer 5040, Serial Number: 06.146573).

For Spectrophotometry:

Spectrophotometer (UVmini-1240 Serial number A109347)

For agarose gel electrophoresis:

Electronic balance (Radwag Model: AS 220.R2 serial number: 487306),                              hotplate (Lennox B212),                                                                                                 Electrophoresis tank (Fischer Scientific tank 2 Serial number: 150803003),                           Power pack (Fischer Scientific Power Pack 2 Model: NANOPAC-300 Serial number: 1507289028),

For PCR:

U.V light chamber (Benchtop Variable Transilluminator M-26XV serial number: T031511-001), PCR analyser (PXE 0.5 Thermo Thermal cycler serial number: PXE 5520192).

 

 

 

 

The methods used were as follows:

The procedure for gram negative bacterial preparation was as follows:

The cells were harvest by centrifuging a 1.5ml pellet of an overnight bacterial broth culture for 2 minutes at 13,000rpm. The culture medium was removed completely and discarded. The cells (pellet) were resuspended thoroughly in 180µL of lysis solution T. An RNase A treatment was used, where 20µL of RNase a Solution was added, mixed and incubated for 2 minutes at room temperature. The Enzyme digester was kept on ice when not in use. The cells were prepared for lysis by adding 20µL of the Proteinase K solution to the sample. Was mixed and incubated for 30 minutes at 55°C. The cells were lysed by adding 200µL of Lysis Solution C, vortexed thoroughly for 15 seconds and incubated at 55°C for 10 minutes.

The procedure next for DNA isolation from gram negative bacteria was as follows:

The column was prepared by adding 500µL of the column preparation solution to one pre-assembled GenElute Miniprep Binding Column (with a red o-ring) sealed in a 2ml collection tube. It was then centrifuged at 12,000 rpm for 1 minute. The eluate was then discarded. The binding was prepared by adding 200µl of ethanol to the lysate and mixed thoroughly by vortexing for 10 seconds.

The Lysate was loaded by transferring the entire contents of the tube into the binding column. A wide bore pipette tip should have been used to reduce shearing the DNA but due to misinterpretation of the manual, a micropipette tip was used instead. The binding column was then centrifuged at 7,000 rpm for 1 minute. The collection tube containing the eluate was discarded and the column was placed in a new 2ml collection tube.

For the first wash, 500µl of Wash Solution 1 was added to the column and centrifuged for 1 minute at 7,000 rpm. The collection tube containing the eluate was discarded and the column was placed in a new 2ml collection tube.

For the second wash, 500µl of Wash Solution Concentrate with EtOH added, was added to the column and centrifuged for 3 minutes at 13,000 rpm to dry the column. The column was centrifuged for an additional 1 minute at 13,000 rpm as residual ethanol was seen. The collection tube was emptied and reused for this additional step. Finally, the collection tube containing the eluate was discarded and the column was placed in a new 2ml collection tube.

The DNA was then eluted, where 200µl of the Elution Solution was pipetted directly onto the center of the column. To increase the elution efficiency, the column was incubated for 5 minutes at room temperature after adding the Elution Solution and then centrifuged for 1 minute at 7,000 rpm to eluate the DNA. A second elution was collected by repeating the last step with an additional 200µl of Elution Solution and eluting into the same 2ml collection tube as used for the first eluate. The eluate was stored at 2-8°C until it was ready to be used next.

The procedure for the determination of the quantity and quality of extracted genomic DNA was as follows:

The spectrophotometer was set up for reading in the UV range. 50µl of the extracted genomic DNA was added to 1,450µl of sterile distilled water. This was a 1 in 30 dilution of the DNA extracted. This was mixed well. 1.5ml of sterile distilled water was added into one UV cuvette, which was the blank. 1.5ml of diluted DNA sample was added to another UV cuvette. The spectrophotometer was zeroed using the blank at wavelength 260nm and the sample was then read and recorded. The spectrophotometer was zeroed again using the blank at wavelength 280nm and the sample was then read and recorded. The A₂₆₀/A₂₈₀ ratio was then calculated to determine the quality of the extracted genomic DNA.

Calculations:

The stock concentration of DNA was then calculated to determine how much DNA was eluted.

1 absorbance unit = 50ng/µl of DNA.

The DNA sample had an absorbance of 0.016 at 260nm.

The equation used to calculate the actual amount of DNA (ng/ul) in the sample was:

Absorbance at 260nm x dilution factor 30 (diluted 1/30) x 50 (1 absorbance unit =50ng/µl DNA).

Therefore: (0.016) (30) (50) = 24ng/µl which is the stock concentration.

The working concentration of DNA (100ng/µl), which is how much of the stock concentration is needed to be diluted to get 100ng/µl which is the working solution for PCR, was not calculated as the yield of extracted genomic DNA was too low, less than 100ng/µl. Therefore, the stock solution concentration became the working solution concentration.

The genomic DNA isolated from the E. coli isolates was then assessed by running it on agarose gel

A 1.0% agarose solution (0.4007g of agarose powder in 40mls 1X TAE buffer) was prepared. The solution was then brought to the boil, using a magnetic stirrer, to dissolve the agarose. The solution was then cooled down to 60°C using an incubator and thermometer. 4ul of Gel red was added to the agarose solution and swirled gently. The gel was then poured onto a rack in the electrophoresis chamber. The comb was inserted at one side of the gel, 5mm from the end of the gel. When the gel had cooled down and became solid, the comb was carefully removed. The chamber was then filled up to the indicated line with 1X TAE buffer. The gel was completely covered with 1X TAE. A micropipette was used to inject 12µl of stained DNA, which was prepared by adding 10µl of genomic stock DNA plus 2µl of loading dye. A molecular weight ladder was included in the gel. 2µl of the marker plus 2µl of loading dye and 8µl of dH₂O was made up. 10µl of the molecular weight marker was injected carefully into the first well. 10µl of the DNA sample was carefully loaded into the second well. The lid of the electrophoresis chamber was then attached and the current of 60V for 40 minutes was applied. When the DNA ladder and the DNA sample reached the bottom of the gel. The current was stopped. The gel was then viewed under U.V light and results recorded.

The PCR was then used to amplify the specific gene sequence as follows:

Firstly the concentrations for the forward and reverse primers used had to be calculated.

Calculations:

Forward primer:

Original concentration = 104pmol/µl

Required concentration = 25pmol/µl

Required volume = 50µl

Volumes of primer =?

Final working concentration of primer = (25) (50) = 12µl

104

Reverse primer:

Original concentration = 118pmol/µl

Required concentration = 25pmol/

µ

l

Required volume = 50µl

Volume of primer =?

Final working concentration of primer = (25) (50) = 10.6µl

118

The PCR master mix was prepared as follows using table 1.0 below. Instead of making up the reaction mix for one sample, it was made up as a batch for five samples as it was required for the sample, positive and negative controls. It was also made up to account for five samples in case of pipetting errors due to small volumes being used. The Taq DNA polymerase was added last after the sample and controls were added.

Since 1µl was required of the primers in the master mix, had to calculate the concentration of the primers used as follows:

Calculations:

Forward primer:

Original concentration = 104pmol/µl

Volume of primer = 1µl

Required volume = 50µl

Required concentration =?

Required concentration = (104) (1) = 2.08pmol/µl

50

Reverse Primer:

Original concentration = 118pmol/µl

Volume of primer = 1µl

Required volume = 50µl

Required concentration =?

Required concentration = (118) (1) = 2.36pmol/µl

50

 

 

 

 

 

 

 

 

 

 

 

 

Table 1.0: PCR master mix preparation

Title: PCR master mix required reagents ad quantities
PCR Reagent	50µl volume per sample reaction	Volume (µl) x 5 samples reactions (PCR Master Mix)
Nuclease free water	20.3	101.5
NTP’s	8.0	40
5X Green Flexi Buffer	10.0	50
MgCl2	5.0	25
Primer F	1	5
Primer R	1	5
Taq DNA polymerase	0.5	2.5
Template Volume	4.2	20.83

Five PCR reaction tubes were set up in the stand. Two tubes were labelled for the sample, two tubes labelled for the positive control and one tube labelled for the negative control.

Into a 1.5ml reaction tube, the appropriate amount of each ingredient according to the table 1.0 in the last column was added into the tube. All the ingredients were mixed by pipetting the solution up and down 5 times.

Once the master mix was made up excluding the taq DNA polymerase, the sample, positive and negative controls. 45.8ul of the master mix was aliquot into the 5 labelled PCR reaction tubes.

4.16µl of the sample, positive and negative controls were added to the appropriate reaction tubes. The final volume was 50µl in the PCR reaction tubes based on 100ng/µl of the working concentration of the extracted DNA but since only 24ng/µl was extracted,

100ng/µl divided by 24ng/µl = 4.16µl which was the amount then of the sample, positive and negative controls added to the master mix.

The PCR reaction tubes, three of which were used (sample, positive and negative controls) were placed in the PCR thermal cycler and the appropriate cycle was initiated.

In addition to using a manual PCR master mix, a commercial master mix was also used. The commercial master mix contained all the nucleotides, Flexi Buffer, MgCl2 and taq polymerase but not the primers. PCR was carried out again on the same sample and positive and negative controls but this time using the commercial master mix and was run alongside the manual master mix in the PCR thermal cycler. This time the volume of the master mix used was 25µl for one sample, so a batch that made up five samples used 125ml of master mix. The required volume of water required for the batch master mix was 94µl.

PCR gyrA Programme used:

94°C – 5minutes

93°C – 1minute

55°C – 1minute                – x 40 cycles

72°C – 1minute

75°C – 5minutes

4°C – Hold

When the PCR was completed, the PCR products were then checked by running them on an agarose gel. The agarose gel was made up the same way as the previous gel was made. Therefore refer to the method above on how the gel electrophoresis was carried out. The only deviations made to the method for the PCR products was that no loading dye was required as the PCR master mix used Green Flexi buffer, so 12µl of the sample was added directly to the agarose gel. However, the Hyper ladder II required a loading dye only.

The samples were injected in the following order:

Well 1 = DNA ladder

Well 2 = blank (well was damaged)

Well 3 = Sample

Well 4 = Positive control          -Traditional master mix

Well 5 = Negative control

Well 6 = Sample

Well 7 = Positive control          -Commercial master mix

Well 8 = Negative control

The gel was then ran and the results viewed using a U.V light box.

Blast was used to input the nucleotide query sequence which was the gyrA sequence. The gyrA query sequence imputed into BLAST was:

GAGGAAGAGCTGAAGAGCTCCTATCTGGATTATGCGATGTCGGTCATTGTTGGCCGTGCGCTGCCAGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACGTACTAGGCAATGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCATGGTGACTCGGCGGTTTATGACACGATCGTCCGTATGGCGCAGCCATTCTCGCTGCGTTACATGCTGGTAGACGGTCAGGGTAACTTCGGTTCCATCGACGGCGACTCTGCGGCGGCAATGCGTTATACGGAAATCCGTCTGGCGAAAATTGCCCATGAACTGATGGCCGATCTCGAAAAAGAGACGGTCGATTTCGTTGATAACTATGACGGCACGGAAAAAATTCCCGACGTCATGCCAACCAAAATTCCTAACCTGCTGGTGAACGGTTCTTCCGGTATCGCCGTAGGTATGGCAACCAACATCCCGCCGCACAACCTGACGGAAGTCATCAACGGTTGTCTGGCGTATATCGATGATGAAGACATCAGCATTGAAGGGCTGATGGAACACATCCCGGGGCCGGACTTCCCGACGGCGGCAATCATTAACGGTCGTCGCGGTATTGAAGAAGCTTACCGTACCGG.

The BLAST result gave information on the alignment of this sequence with sequences in its database. BLAST gave a maximum score of how well the query sequence compared with the database sequences. BLAST gave information on the genome.

Then the forward and reverse primer nucleotide sequences were inputted into BLAST as well.

The Forward primer sequence was: gyrAF1 5’-GAGGAAGAGCTGAAGAGCT-CCT

The Reverse Primer sequence was: gyrAR1 5’- CCGGTACGGTAAGCTTCTT-CAA

BLAST provided detailed information such as the forward and reverse primer start positions, the melting temperature which was important for the PCR reaction in the annealing step, where the temperature. BLAST gave the percentage of G and base pairs, as well as how well the forward and reverse primers complement each other.

PubMed, the free database was used to search, under nucleotide, E. coli 8739. The database gave information regarding the specific enzyme and the list of different gyrases. POAE54 gyrase was selected in this case and it brought up the whole sequence for it.

 

 

 

 

 

 

 

 

4.0. Results

The quantity and quality of extracted genomic DNA was determined by measuring the absorbance of the extracted DNA at the two wavelengths, 260nm and 280nm and the ratio of A260/A280 was then determined. This is recorded in table 1.0 below.

Table 1.1: Results of the absorbance readings of the DNA extracted at wavelengths 260nm and 280nm

Title: Absorbance results at wavelengths 260nm and 280nm for extracted Genomic DNA
Wavelength	A260nm	A280nm
Sample	0.016	0.006

Calculations:

The ratio of A₂₆₀/A₂₈₀ was then determined

A₂₆₀ = 0.016

A₂₈₀ = 0.006

The ratio is therefore 0.016/0.006 = 2.6

This ratio was high.

The stock concentration of DNA was then calculated to determine how much DNA was eluted.

1 absorbance unit = 50ng/µl of DNA.

The DNA sample had an absorbance of 0.016 at 260nm.

The equation used to calculate the actual amount of DNA (ng/ul) in the sample was:

Absorbance at 260nm x dilution factor 30 (diluted 1/30) x 50 (1 absorbance unit =50ng/µl DNA).

Therefore: (0.016) (30) (50) = 24ng/µl which is the stock concentration.

The working concentration of DNA (100ng/µl), which is how much of the stock concentration is needed to be diluted to get 100ng/µl which is the working solution for PCR, was not calculated as the yield of extracted genomic DNA was too low, less than 100ng/µl. Therefore, the stock solution concentration became the working solution concentration

Agarose gel electrophoresis was carried out on the extracted genomic DNA before and after PCR. Two different molecular weight ladders were used both times, in order for the size of the DNA extracted to be determined. In figure 1.0 below is the molecular weight ladder used for the first gel:

Figure 1.0: Hyper Ladder II Bioline, the Molecular weight ladder used in the first gel electrophoresis. The target DNA extracted should be in the 10,037 base pair region.

Agarose gel electrophoresis was first used to clarify that DNA was isolated before going onto PCR. The result of the gel electrophoresis of the extracted genomic DNA is shown in figure 1.1 below:

Figure 1.1: Gel electrophoresis result of extracted Genomic DNA before it was subjected to PCR. The sample well has a band in the slightly greater than 10,037 base pair region.

Figure 1.2: Hyper Ladder II Bioline that was the molecular weight ladder used in the second gel electrophoresis of the PCR products. The target DNA has a band in the 668 base pair region.

The fragment of the gyrA gene that was extracted, was then amplified using PCR. Two different PCR master mixes were used. The PCR products were then ran on another gel to see if the gene was successfully amplified. The results of this second gel are shown in figure 1.3 below:

Figure 1.3: Gel electrophoresis result of the PCR products

The controls did not work as there was bands present in the negative control and the positive control had more than one band present. Also the results of the gel electrophoresis of the PCR products showed that were primer dimers in all the wells. There was smearing present in the wells. The bands are not defined. The hyper ladder bands were are well defined only.

 

5.  Discussion

This workshop incorporated some of the fundamental techniques used in Molecular Biology. The techniques utilized in this workshop were Genomic DNA extraction, U.V spectrophotometry, agarose gel electrophoresis, polymerase chain reaction, BLAST and PubMed utilization.

The aim of this workshop was to amplify a specific gene which was the gyrA gene found in E. coli. This particular gene has been shown to enable the bacteria resistance to quinolones. In order to amplify this particular gene of interest, the gene first had to be extracted from the bacteria. The strain of E. coli used was ATCC 25922.

The genomic DNA isolated from E. coli was carried out using the kit method. The particular kit used in this workshop was GenElute Bacterial Genomic DNA Kit. This involved disruption and lysis of the bacterial culture, followed by removal of contaminants and lastly retrieval of the genomic DNA. It was important to remove the contaminants and protein as this could have affected the quality of the DNA. It was also important to remove all of the ethanol in the washing steps, where a second washing step was added, as this would affect the yield, where the yield could be improved by 20 – 50% by performing a second washing step.

U.V spectrophotometer was used to check both the quality and how much DNA was isolated. Quality of the extracted DNA was determined to see whether the sample was pure i.e. no protein or RNA present using the ratio of two wavelengths. A ratio of the two wavelengths A260/A280 was used to determine this. This was used as nucleic acids, RNA and DNA absorb light at 260nm and protein absorbs at 280nm. Therefore a ratio of 1.8 – 1.9 meant that there was pure DNA in the sample. A ratio of 1.9 – 2.0 indicated high amounts of RNA in the sample. A low ratio meant that there was protein in the sample. Applying this knowledge to results received in this workshop to the sample extracted. The ratio calculated was 2.6. This indicated that there was high amounts of RNA in the sample, meaning that the sample did not have pure DNA.

The yield of DNA was calculated using the absorbance value at 260nm, which was 24ng/ul. This was a low yield of DNA extracted. However, there probably was a lower yield of DNA present in the sample due to the sample obtained was determined to be not pure DNA as the ratio of the two wavelengths was high.

Gel electrophoresis was used to clarify that DNA was isolated, before going onto PCR. In the making up of the gel, Gel red was added at the end. Gel red allows DNA to bind to the gel as well as staining the DNA to allow it to be visualized as it travels through the gel in order to know when the gels were done. A loading dye was used as it increases the density of the sample so it would load into the well and not disperse.

The sample containing the possible extracted DNA was run in one well, along with a hyper ladder. The hyper ladder is a molecular weight ladder, which allows unknown DNA size to be determined through comparison with the molecular weight ladder run alongside the sample. The heavier DNA (more base pairs) migrate the least distance through the gel. In this instance the DNA extracted was determined to be slightly greater than 10,037 base pairs, as the DNA band in the sample well was slightly higher up in the gel than the first band in the hyper ladder well.

When taking out the gel after the first gel electrophoresis, it split into two pieces. However, since this occurred after the samples had migrated through the gel and the results of the well were still visible and not distorted by the crack. It was still okay to still read and interpret the results. The possible reasons for the gel breaking could have been due to the gel not being fully harden when making it up.

PCR was used to amplify if present the gyrA gene in the DNA that was extracted from E. coli. This technique allowed rapid production of multiple copies of the gene of interest. The target DNA was able to be specifically amplified using primers. Forward and reverse primers which were complementary to the target DNA were used. The taq polymerase extended the primers by adding nucleotides, the building blocks.

Before it was possible to read the results of the samples in the gel electrophoresis of the PCR products, the controls had to be read first in order to determine if the methods used were valid as in they gave correct results. Positive and negative controls were ran alongside the samples, in order to see if the technique used gave correct results and therefore a valid procedure. The positive control gave a positive result but the negative control wasn’t negative and in fact gave  positive results due to bands present in the gel result. However, the positive control had more than one band present in the well. Therefore, in a clinical setting the results of this technique would not have been used and the procedure repeated. In addition, well two in the gel was left empty due to that well being damaged. However, from the result of this gel showed a single band present. A possible explanation for this could be due to that well being damaged and samples in the neighboring wells leaked into this well.

In PCR, two different master mixes were prepared: traditional and commercial master mixes. The commercial master mix contained nucleotides, flexi buffer, MgCl2and taq polymerase. It did not contain primers. The traditional master mix had to be made up. These two different master mixes were compared and found to produce the sample results from analysis on the gel. Therefore, the only advantage the commercial master mix had over the traditional master mix was that less steps had to be used to make up the PCR master mix and so less time using the commercial one.

Since the controls were read but were invalid so the test could not be used to read samples, this method should have been repeated or discarded. But for learning purposes, the controls were assumed to be valid and the samples were continued to be read. The results of the gel was that the target DNA was extracted and amplified successfully due to a band present in the 600 – 700 base pair region when compared with the hyper ladder well as the gyrA gene is 668 base pairs in length.

Other analyses of the gel result of the PCR products was that there were primer dimers present in all the wells as there were two bands present in the wells. One in the 600 – 700 region (gyrA gene) and the other in the 50 or less base pair region. Primer dimers are a byproduct of PCR. Primer dimers are primers that have become hybridized to each other due to strings of complementary bases between the primers. Possible causes of primer dimers are the template DNA contaminated, the annealing temperature is too low, and there is two primer binding sites in the template DNA (Graham and Holland, 2005).

There was smearing present in the wells. This could be due to a badly prepared gel. Where the gel had set before it was before it was fully poured into the tray, leading to an uneven gel. Loading undiluted samples which cause the sample to flow into other wells as the sample is too large for the well. The quality samples can cause smearing, where the DNA contaminated with protein can cause smearing (Zhang et al., 2004).

BLAST was used, where the query sequence of the extracted DNA from  E. coli ATTCC 8739 was inputed into BLAST. The query gyrase sequence was entered into BLAST and compared with the organism 8333 E. coli K-12 in the database. The BLAST result was a distribution of 31 BLAST hits on the query sequence and were found to have 100 percent alignment with the query sequence.

The forward and revere primers used in this study were also inputed into BLAST. BLAST provided information regarding the sequence of the primers, their product length, and also the position they start at. The forward primer binds with the template DNA at position one base pair and the reverse primer binds at position 668 base pairs.

Template DNA (DNA region of interest)

5’                                                                                                                                                  3’

TTGAAGAAGCTTACCGTACCGG

AACTTCTTCGAATGGCATGGCC

3’                                                             5’

Reverse primer

Forward Primer

5’                                                                   3’

GAGGAAGAGCTGAAGAGCTCCT

CTCCTTCTCGACTTCTCGAGGA

3’                                                                                                                                                               5.         Template DNA (DNA region of interest)

Figure 1.4: Schematic diagram of where the forward and reverse primers bind with the target DNA.

PubMed provided information about E. coli 8739 nucleotide sequence and the different gyrase, which POAE54 was selected. Both BLAST and PubMed provided information about the forward and reverse primers.

PubMed was also used to look at previous studies carried out like this workshop. It was found that the kit method is still used for Genomic DNA extraction, with many kits available depending on the requirements of the user. The PCR program ranges around the 40 cycles. No smearing was evident in their gels.

6.0 Conclusion

The extraction of gyrA gene can be successfully isolated from E. coli using the kit method. Its quality and quantity can be determined spectrophotometrically. Gel electrophoresis can be used to clarify that DNA is extracted. PCR is able to amplify the target sequence. Gel electrophoresis can also be used to identify if your DNA extracted is pure. Molecular tools, BLAST and PubMed provide possible identify of the isolated DNA such as the possible organisms it could be, the primers to be used and PCR conditions.

 

 

 

 

 

 

 

 

 

 

 

 

 

7.0 References:

Graham, K. and Holland, M. (2005). PrimerSelect: A Transcriptome-Wide Oligonucleotide Primer Pair Design Program for Kinetic RT-PCR–Based Transcript Profiling. Methods in Enzymology, pp.544-553.

Lee, P., Costumbrado, J., Hsu, C. and Kim, Y. (2012). Agarose Gel Electrophoresis for the Separation of DNA Fragments. Journal of Visualized Experiments, (62).

Lucena-Aguilar, G., Sánchez-López, A., Barberán-Aceituno, C., Carrillo-Ávila, J., López-Guerrero, J. and Aguilar-Quesada, R. (2016). DNA Source Selection for Downstream Applications Based on DNA Quality Indicators Analysis. Biopreservation and Biobanking, 14(4), pp.264-270

Maheaswari, R., Kshirsagar, J. and Lavanya, N. (2016). Polymerase chain reaction: A molecular diagnostic tool in periodontology. Journal of Indian Society of Periodontology, 0(0), p.0.

Oehmen, C. and Nieplocha, J. (2006). ScalaBLAST: A Scalable Implementation of BLAST for High-Performance Data-Intensive Bioinformatics Analysis. IEEE Transactions on Parallel and Distributed Systems, 17(8), pp.740-749.

Qui, H., Gong, J., Butaye, P., Lu, G., Huang, K., Zhu, G., Zhang, J., Hathcock, T., Cheng, D. and Wang, C. (2018). CRISPR/Cas9/sgRNA-mediated targeted gene modification confirms the cause-effect relationship between gyrA mutation and quinolone resistance in Escherichia coli. FEMS Microbiology Letters, 365(13).

Roberts, R. (2001). PubMed Central: The GenBank of the published literature. Proceedings of the National Academy of Sciences, 98(2), pp.381-382.

Sigma-Aldrich. (2018). GenElute Bacterial Genomic DNA Kit Protocol. [online] Available at: https://www.sigmaaldrich.com/technical-documents/protocols/biology/genelute-bacterial genomic-dna-kit.html [Accessed 11 Sep. 2018].

Yoshikawa, H., Dogruman-AI, F., Turk, S., Kustimur, S., Balaban, N. and Sultan, N. (2011). Evaluation of DNA extraction kits for molecular diagnosis of human Blastocystis subtypes from fecal samples. Parasitology Research, 109(4), pp.1045-1050.

Zhang, Y., Yakrus, M., Graviss, E., Williams-Bouyer, N., Turenne, C., Kabani, A. and Wallace, R. (2004). Pulsed-Field Gel Electrophoresis Study of Mycobacterium abscessus Isolates Previously Affected by DNA Degradation. Journal of Clinical Microbiology, 42(12), pp.5582-5587.